• Users Online: 1101
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 39  |  Issue : 4  |  Page : 163-171

Expression of foreign proteins by antimicrobial peptide gene promoters in mosquitoes


1 Institute of Preventive Medicine; Department and Graduate Institute of Microbiology and Immunology, National Defense Medical Center, Taiwan, Republic of China
2 Institute of Preventive Medicine, National Defense Medical Center, Taiwan, Republic of China
3 Department and Graduate Institute of Microbiology and Immunology, National Defense Medical Center, Taiwan, Republic of China

Date of Submission12-Dec-2018
Date of Decision20-Jan-2019
Date of Acceptance29-Jan-2019
Date of Web Publication13-Aug-2019

Correspondence Address:
Dr. Chang-Chi Lin
Institute of Preventive Medicine, National Defense Medical Center, Taiwan
Republic of China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jmedsci.jmedsci_194_18

Rights and Permissions
  Abstract 

Background: The mosquito Aedes aegypti is a major vector for transmission of viruses causing dengue fever, yellow fever, Zika, and chikungunya infection. Functional analysis of mosquito genes and individual viral genes can be a powerful approach to study vector–virus interactions but is often hampered by a lack of suitable promoters to drive exogenous viral gene expression in mosquito cells in vitro and in vivo. Object: To search for potential promoter candidates that can be used to express foreign genes and particularly viral proteins in a mosquito model system. Materials and Methods: we characterized the ability of the promoters of three Ae. aegypti antimicrobial peptide (AMP) genes to drive the expression of marker proteins (luciferase, GFP, the NS3 protein of two flaviviruses, and rabies virus glycoprotein) in mosquito cells and adult female mosquitoes, and in other insect cells as well. Results: The promoters of the defensin A4 and cecropin B1 genes produced robust expression of luciferase and GFP in the Ae. aegypti cell line CCL125, Aedes albopictus cell line C6/36, Drosophila melanogaster cell line S2, and Spodoptera frugiperda cell line Sf21. These AMP gene promoters also had the ability to drive NS3 and GFP expression in adult tissues of Ae. aegypti, Ae. albopictus, and Culex tritaeniorhynchus in vivo, which may suggest evolutionary conservation of AMP gene promoter activity across mosquito lineages. Conclusions: These promoters could provide a valuable tool for ectopically expressing viral genes and studying their interactions with the mosquito vectors.

Keywords: Expression promoter, antimicrobial peptide gene, mosquito


How to cite this article:
Lin CC, Chen YH, Guan TC, Chang SW, Pai H, Chou SJ, Tsai HP. Expression of foreign proteins by antimicrobial peptide gene promoters in mosquitoes. J Med Sci 2019;39:163-71

How to cite this URL:
Lin CC, Chen YH, Guan TC, Chang SW, Pai H, Chou SJ, Tsai HP. Expression of foreign proteins by antimicrobial peptide gene promoters in mosquitoes. J Med Sci [serial online] 2019 [cited 2019 Oct 20];39:163-71. Available from: http://www.jmedscindmc.com/text.asp?2019/39/4/163/257758




  Introduction Top


Aedes aegypti is the most important vector for transmission of viruses that cause dengue fever, yellow fever, chikungunya fever, and Zika fever worldwide. Currently, the most effective way to control mosquito-transmitted diseases is to reduce mosquito populations by habitat reduction and insecticide application, but such measures are labor intensive and can have unwanted impacts on the environment. The lack of effective vaccines (except for yellow fever) and the emergence of insecticide-resistant mosquitoes have urged the development of other control strategies, such as genetic approaches to generate mosquitoes with pathogen-resistant phenotypes.[1],[2],[3],[4] Production of pathogen-resistant or immunocompetent transgenic mosquitoes requires gene promoters that can drive expression of foreign genes or siRNA in an appropriate manner.

Several promoter fragments from genes of Ae. aegypti able to drive the expression of transgenes in transformed mosquitoes have been characterized, including the carboxypeptidase A promoter to drive inverted RNA of dengue virus 2 (DenV2) in midgut;[2] the vitellogenin promoter to strongly drive the defensin coding region in fat body and hemolymph following a blood meal [3] or to drive Rel2 in fat body, resulting in expression of defensins and cecropins after a blood meal;[1] the nanos promoter to express exogenous MosI transposase [5] in the ovary; the actin-4 promoter to induce a repressible female-specific flightless phenotype;[6] the beta2 tubulin promoter to express the DsRed gene in testis;[7] the Hsp70 promoter to drive expression of luciferase in adult mosquito after heat shock;[8] the Ub and polyubiquitin promoters to drive luciferase and GPF expression in culture and adult mosquitoes;[9] the Maltase-like I and apyrase gene promoters to drive constitutive expression of luciferase in Aedes albopictus C6/36, Drosophila Schneider Line 2 cells, and transformed mosquitoes;[10] the salivary protein 30 k promoter to drive an inverted repeat RNA with sequences derived from the premembrane gene of dengue 2 virus, resulting in reduced viral infection;[4] and three regulatory regions of the glutamine synthetase gene that differentially regulate its expression.[11] Of these promoters, some are tissue dependent,[2],[3],[4],[5],[7],[12],[13],[14] some are stage dependent,[6],[9],[10] and some are feeding or temperature dependent.[1],[2],[3],[8],[15],[16] The use of mosquito gene promoters for tissue- or stage-specific manipulation of the mosquito immune defense pathway is a powerful approach for understanding the gene function in the context of host–pathogen interactions as well as for counteracting mosquito-borne diseases.

In the present study, we analyzed three promoters (defensin A1, defensin A4, and cecropin B1) of antimicrobial peptide (AMP) genes and of one Hsp70 gene from Ae. aegypti for their ability to drive high constitutive expression of exogenous proteins (GFP and NS3 proteins of two flaviviruses) in the mosquito cell lines C6/36 and CCL125, Drosophila S2 cells, and Spodoptera frugiperda (moth) Sf21 cells. The A4 and B1 promoters functioned in adult female mosquitoes in vivo, expressing NS3 and GFP in tissues of Ae. aegypti, Ae. albopictus, and Cx. tritaeniorhynchus. The glycosylated G protein gene of rabies virus was also expressed in mosquito cells under the control of B1 promoter. The results revealed that the promoter activities of these AMP genes from Ae. aegypti are conserved evolutionarily in the dipteran lineage and could be a valuable tool for expressing viral proteins and assaying their interactions with host proteins of mosquito vectors.


  Materials and Methods Top


Mosquito rearing

The Ae. aegypti Kaohsiung strain, Ae. albopictus Chung-Ho strain, and Cx. tritaeniorhynchus Peitou strain were reared at 27°C and 80% humidity, as described previously.[17] Adult female mosquitoes used for intrathoracic injection were aged 1–5 days after emergence from pupal cases.[18],[19]

Cell lines

Mosquito cell lines – CCL125 (ATCC, Ae. aegypti) and C6/36 (Ae. albopictus) were cultured in RPMI 1640 medium (GIBCO, Invitrogen, CA) with 10% fetal bovine serum, 50 units/ml penicillin G, 50 mg/ml streptomycin, 2 mM L-glutamine, and 25 mM HEPES in a humidified atmosphere of 5% CO2 at 28°C. The S2 cell line (Drosophila melanogaster) was cultured in Schneider's insect medium (USBiological, MA) with 10% fetal bovine serum in 5% CO228°C. The Sf21 cell line (S. frugiperda) was cultured in TC100 medium (USBiological, MA) with 10% fetal bovine serum in 5% CO2 at 28°C. Rodent BHK21 cells were cultured in RPMI 1640 medium with 10% fetal bovine serum.

DNA constructs

The promoters of the defensin A1, defensin A4, cecropin B1, and heat shock protein (Hsp) genes from Ae. aegypti were polymerase chain reaction (PCR) amplified using adult mosquito genomic DNA as template and the following primers: A1-forward ACACGCTAGAACACGTAAG, A1-reverse GATAATCGACGAGCTCTGCG; A4-forward AATTCGGTGACCCACTAGATC, A4-reverse GTG CTAATCAAACAGCTGAG; B1-forward GCC TACACTCAAATGTTCATCAATGG, B1-reverse TC AAGCTTTCACTGGAATAGGTGA; Hsp-forward TCC AGTCTTTTTGAAGTCGCGAA, Hsp-reverse CTTTAA TTAGTGTTGTTTTGACGAGA. The sizes of the amplified A1, A4, B1, and Hsp promoters were 1063nt, 1239nt, 1868nt, and 675nt, respectively, and all were cloned into pGL3 basic vector (Promega, WI, USA) between the Nhe I and Bgl II restriction enzyme sites and tested for luciferase expression. The luciferase gene in the pGL3 basic-A1, pGL3 basic-A4, and pGL3 basic-B1 constructs were replaced with the GFP gene or the NS3 gene of Japanese encephalitis virus (JEV) or DenV2 between the Nco I and Xba I sites for GFP or NS3 protein expression. The GenBank accession numbers are HQ256583 and HQ256580 for NS3 of JEV and DenV2, respectively. pCMV-GFP (Invitrogen, CA, USA) was used as a GFP control plasmid. The plasmids – pGL3-A1, pGL3-A4, pGL3-B1, pGL3-Hsp, pGL3-A1-GFP, pGL3-A4-GFP, pGL3-B1-GFP, pGL3-A4-JENS3, pGL3-B1-JENS3, pGL3-A4-D2NS3, pGL3-B1-D2NS3, and pCMV-GFP were sequenced to confirm the insertions and prepared by QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany).

The rabies virus G protein gene plasmid (pGL3-B1-G) was constructed using inactivated VERORAB vaccine (Sanofi, Lyon, France) to obtain RNA template and RT-PCR methods (using primers forward-GGGAAGTTCCCCATTTACACGAT, reverse-CTGTTTATGCACATCGGGGAG) to amply the G-specific coding region, which was used to replace the luciferase gene between the Nco I and Xba I restriction enzyme sites downstream of the B1 promoter. The G protein gene of pGL3-B1-G was sequenced and found to be identical to the G gene of the rabies virus PM strain (GenBank accession number AJ871962), with 3–4 potential N-glycosylation sites within the encoded protein.

Luciferase assays

C6/36, CCL125, S2, and Sf21 cells were cultured in 12-well plates at about 1 × 10[5] cells per well. The plasmids – pGL3-A1, pGL3-A4, pGL3-B1, and pGL3-Hsp (0.2 mg/well) were transfected into C6/36 and CCL125 cells using Fugene HD transfection reagent (Roche, Indiana) and into S2 and Sf21 cells using Cellfectin II reagent (Invitrogen, CA, USA) according to the manufacturers' instructions. The cells were lysed with passive lysis buffer (Promega, CA, USA), and luciferase activity was assayed (BioThema, Sweden) in a microplate scintillation format and luminescence counter (Packard, PerkinElmer, CT, USA) 48-h posttransfection. The luciferase activities were normalized with the protein concentration in each well. In vivo luciferase assays were performed by mixing the plasmids with TurboFect™ in vivo reagent (Fermentas, Canada), followed by intrathoracic microinjection of 98 nl (~50 ng of plasmid DNA) into adult female mosquitoes;[18],[19] homogenates of individual mosquitoes were assayed for luciferase activity 5-day postinjection.

Microscopy and fluorescence analysis

Expression of GFP from the constructs – pGL3-A1-GFP, pGL3-A4-GFP, and pGL3-B1-GFP in C6/36, CCL125, and S2 cells was detected by fluorescence microscopy (IX70, Olympus), and images were captured by a SPOT RT3™ camera (SPOT™ Imaging Solutions, Sterling Heights, MI). Expression of GFP in fat body of female adult mosquitoes was detected 5 days after intrathoracic microinjection [19] of 98 nl (~50 ng plasmid DNA) of pGL3-A4-GFP or pGL3-B1-GFP by microdissecting fat body onto a slide and examining the tissue by fluorescence microscopy (Zeiss Axio Scope A1 fluorescent microscope; Carl Zeiss, Germany); images were captured with Canon EOS 450D digital system (Canon, Japan).

Antibodies and Western blotting

Polyclonal antibody against GFP was purchased from Gene Tex (San Antonio, TX, USA). Monoclonal antibody against alpha-tubulin was purchased from Sigma-Aldrich Biotechnology (St. Louis, MO, USA). Monoclonal anti-rabies G antibody was from Applied Biological Materials (Richmond, BC, Canada). Rabbit polyclonal antisera specifically recognizing aegSTAT and albSTAT were generated using a His-tagged aegSTAT or albSTAT C-terminal fusion protein as antigen to immunize New Zealand White rabbits.[17] Monoclonal antibodies against NS3 of JEV and DenV2 were both from the Institute of Preventive Medicine, NDMC (Taiwan, ROC). The C6/36, CCL125, and S2 cells transfected with the indicated plasmids for 48 h were washed twice with phosphate-buffered saline (PBS) and lysed in lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 1 mM ethylenediaminetetraacetic acid) containing 2 mM phenylmethylsulfonyl fluoride and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, then transferred to a nitrocellulose membrane and blocked with 5% skim milk in PBS + 0.1% Tween 20 (PBST). The membrane was incubated with the indicated primary antibody and secondary horseradish peroxidase antibody and washed three times with PBST after antibody incubation, then visualized by using Amersham™ ECL™ Prime Western Blotting Detection Reagent (GE, Healthcare, UK) according to the manufacturer's instructions.

Immunohistochemistry

Adult injected with 50 ng expression vectors (pGL3-A4 or B4-JENS3) for 5 days, mosquitoes were fixed in 10% buffered formalin, paraffin-embedded, and 5-microm cut slices were dewaxed in xylene, rehydrated through graded alcohol, and subjected to an endogenous peroxide blocking. The sections were washed in water, processed for antigen retrieval, and placed in citrate buffer. Nonreactive staining was blocked by treating the sections with 1% goat normal serum in Tris-buffered saline for 20 min. Tissue sections were incubated with anti-NS3 antibody of JEV for 1 h, washed with Tris-buffered saline three times, and then, the bound antibodies were detected using an avidin-biotin-peroxidase complex (Universal Elite ABC kit, Vectastain, CA, USA) for 30 min. Diaminobenzidine tetrahydrochloride solution (Kit HK153-5, Biogenex, CA, USA) was used as a chromogen. Images were detected with a Zeiss Axio Scope A1 microscope (Carl Zeiss, Germany) and captured using a Canon EOS 450D digital system (Canon, Japan).

Data analysis

[Figure 1]a, [Figure 1]b, and [Figure 2]b were constructed using GraphPad Prism software. Statistical analyses for significant differences were carried out with an unpaired t-test using the same software (GraphPad software, San Diego, CA).
Figure 1: (a) Luciferase activity assays of four mosquito promoters in insect cells. Mosquito cell lines – CCL125 and C6/36, Drosophila cell line S2, and moth cell line Sf21 were transiently transfected with luciferase reporter constructs each containing one of four mosquito promoters (A1, A4, B1, Hsp) and a pGL3-Basic vector as a control. Luciferase activity was measured 48-h posttransfection. Relative luciferase activity was normalized to cellular protein concentration. Bar values represent the means of three individual experiments ± standard error of the mean. Significant differences between each promoter reporter and the pGL3-Basic vector were determined by unpaired t-test (*P < 0.05, **P < 0.01, ***P < 0.001). (b) In vivo expressed luciferase activities controlled by four mosquito promoters in three mosquito species. Adult females of three different mosquito species, Aedes aegypti, Aedes albopictus, and Culex tritaeniorhynchus, were intrathoracically injected with luciferase reporters containing four different promoters (A1, A4, B1, Hsp) and control pGL3-Basic vector. Luciferase activity was measured 5-day postinjection. Relative luciferase activity was normalized to each individual mosquito protein concentration. Bars represent the means of three different adult mosquito experiments ± standard error of the mean. Significant differences between each reporter and the pGL3-Basic vector (Basic) were determined by unpaired t-test (*P < 0.05, **P < 0.01, ***P < 0.001)

Click here to view
Figure 2: GFP, driven by three different mosquito promoters, was expressed in three insect cell lines. (a) GFP reporter plasmids – pGL3-A1-GFP, pGL3-A4-GFP, and pGL3-B1-GFP were used to transiently transfect C6/36, CCL125, and S2 cells, and GFP was detected by fluorescent microscopy. Each image was magnified 100×. Mock and pGL3-Basic control assays are not shown. (b) Bars represent the mean number of GFP-positive cells per visual field from three different experiments (*P < 0.05, **P < 0.01). (c) GFP expressed in insect cells was detected by Western blotting. Mosquito cell lines – CCL125 and C6/36 and Drosophila cell line – S2 were transiently transfected with pGL3-A1-GFP, pGL3-A4-GFP, pGL3-B1-GFP, and pGL3-Basic plasmids or mock transfected, cells were lysed 48 h after transfection, and the lysates were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred onto nitrocellulose membrane and detected by anti-GFP antibody. Mammalian cell line BHK21 was transfected with pCMV-GFP plasmid as a positive control. CCL125 cells transfected with pCMV-GFP plasmid showed that GFP was not expressed from the CMV promoter. (d) Glycosylated G protein of rabies virus was also expressed in mosquito cell line CCL125 under the control of the B1 promoter. This G protein construct (pGL3-B1-G) was transfected into the CCL125 cell line for 48 h, the cells lysed for Western blotting, and the blot probed with anti-G monoclonal antibody and reprobed with antialpha tubulin antibody. Inactivated rabies vaccine VERORAB (3 ml) in lane 3 served as a positive control

Click here to view



  Results Top


Construction of protein expression vectors containing promoters of antimicrobial peptide genes from Aedes aegypti

Promoters of the defensin A1, defensin A4, cecropin B1, and heat shock protein genes of the Ae. aegypti Kaohsiung strain were PCR amplified from adult female genomic DNA and cloned into pGL3 basic vector to create pGL3-A1, pGL3-A4, pGL3-B1, and pGL3-Hsp. The GenBank accession numbers of these promoters are HQ285957 to HQ285960. The luciferase gene in these modified pGL3 basic constructs was further replaced by the NS3 gene of JEV or DenV2, the G gene of rabies virus, or the GFP gene to give the following expression vectors: pGL3-A1-GFP, pGL3-A4-GFP, pGL3-B1-GFP, pGL3-A4-JENS3, pGL3-B1-JENS3, pGL3-A4-D2NS3, pGL-B1-D2NS3, and pGL3-B1-G. A diagram of the plasmid constructs is shown in [Figure 3].
Figure 3: Diagram of plasmids showing mosquito promoters (A1, A4, B1, Hsp), exogenous protein genes (luciferase, GFP, G protein of rabies virus, NS3 gene of flavivirus), and the pGL3-Basic vector backbone

Click here to view


Mosquito promoters drive expression of luciferase reporter in several insect cell lines and adult mosquitoes

The four luciferase reporters – pGL3-A1, pGL3-A4, pGL3-B1, and pGL3-Hsp (containing mosquito promoters A1, A4, B1, and Hsp) – showed varying levels of luciferase activity in the two mosquito cell lines – CCL125 (Ae. aegypti) and C6/36 (Ae. albopictus) and the two insect (nonmosquito) cell lines – S2 (fruit fly) and Sf21 (lepidopteran), with the B1 and A4 promoters driving higher luciferase expression than the A1 and Hsp promoters in all four cell lines [Figure 1]a. In CCL125, the luciferase activity driven by the B1 promoter was about 80-fold higher than that driven by the A4 promoter; by contrast, in the heterologous C6/36 cell line, the B1 promoter was less active than the A4 promoter. The same pattern of luciferase activity as observed in the CCL125 cell line was also observed in the S2 and Sf21 cell lines, with activity highest for the B1 promoter, moderate for the A4 promoter, and lowest for A1 and Hsp promoters [Figure 1]a. The above results demonstrated that promoters from Ae. aegypti can drive luciferase expression both in mosquito cell lines and in other insect cell lines, but generally appear to be more efficient in mosquito cells.

To further test that these promoters could drive luciferase activity in adult mosquitoes, the luciferase-containing reporters were intrathoracically injected into adult female mosquitoes of Ae. aegypti, Ae. albopictus, and Cx. tritaeniorhynchus, and then homogenates of individual adult mosquitoes were assayed for luciferase activity 5-day postinjection. [Figure 1]b shows that luciferase expression was more vigorous in Ae. aegypti adult mosquito than in both Ae. albopictus and CX. tritaeniorhynchus adults, and the B1 promoter was more active than A4 and A1 in Aedes mosquitoes whereas the A4 promoter was more active than B1 and A1 in Culex mosquitoes. These results demonstrated that mosquito promoters not only can drive luciferase expression in cell lines but also in adult mosquitoes in vivo.

Mosquito promoters drive expression of GFP in insect cell lines and glycosylated G protein of rabies virus in mosquito cells

To test whether these mosquito gene promoters could drive expression of other exogenous proteins, GFP gene was substituted for the luciferase gene in pGL3-A1, pGL3-A4, and pGL3-B1 to create pGL3-A1-GFP, pGL3-A4-GFP, and pGL3-B1-GFP [Figure 3]. C6/36, CCL125, and S2 cells were transfected with these GFP reporters and examined by fluorescence microscopy 48-h posttransfection. GFP was expressed in all three insect cell lines, with B1 promoter being the strongest in CCL125 and S2 cells and the A4 promoter more active in C6/36 cells [Figure 2]a. For quantitative analysis of the GFP-expressing cells, three independent transfection assays were carried out in each of C6/36, CCL125, and S2 cells, and the numbers of GFP-positive cells were counted in 5 visual fields per experiment to compare the GFP fluorescence among the A1, A4, and B1 promoters [Figure 2]b. The results showed that the B1 promoter was more active in CCL125 and S2 cells, whereas A4 was more active in C6/36 cells, consistent with the results of the luciferase activities in [Figure 1]a. GFP expression was also detected in lysates of these cells by Western blotting [Figure 2]c. The results revealed GFP protein to be more abundant in CCL125 and S2 cells transfected with the B1 promoter construct and in C6/36 cells transfected with the A4 promoter construct, consistent with the results of the GFP experiments in [Figure 1]a and [Figure 2]a, b. As a negative control, the CMV promoter could drive GFP expression in mammalian BHK21 cells as expected, but not in mosquito CCL125 cells [Figure 2]c. To test whether a glycosylated foreign protein could be produced from these mosquito promoters in mosquito cells, the coding region of the G protein gene of rabies virus was inserted downstream of the B1 promoter and the construct was transfected into CCL125 cells; the results showed that glycosylated G protein could be expressed under these conditions [Figure 2]d.

Antimicrobial peptide promoters drive GFP expression in adult mosquitoes in vivo

We further assayed the expression of GFP under the control of the A4 and B1 promoters in Ae. aegypti adult females by intrathoracic injection of pGL3-A4-GFP and pGL3-B1-GFP plasmid (~50 ng DNA per adult mosquito). Microdissected fat body showed GFP fluorescence in both the A4 and B1 promoter transfection experiments, as visualized by fluorescence microscopy [Figure 4]. This result showed that promoters of Ae. aegypti can drive expression of foreign GFP protein in fat body of adult mosquitoes in vivo.
Figure 4: GFP was expressed in fat bodies of adult female mosquito in vivo. Female adult Aedes aegypti were microinjected with pGL3-A4-GFP and pGL3-B1-GFP plasmids (98 nl containing ~ 50 ng DNA per mosquito) left for 5 days. Then, the fat bodies were microdissected on slides and examined by using a Zeiss Axio Scope A1 fluorescent microscope; images were captured by a Canon EOS 450D digital system. The upper panels show fluorescence detection; the lower panels are bright field images. Scale bar = 10 mm

Click here to view


Antimicrobial peptide promoters drive expression of flavivirus NS3 proteins in mosquito cell lines and adult mosquitoes

The above experiments revealed that mosquito gene promoters are able to drive foreign luciferase and GFP protein expression in insect cells in vitro and in vivo. We next replaced the GFP gene with the NS3 gene of JEV or DenV2 to test whether mosquito AMP gene promoters could also drive the expression of this viral protein in mosquito cells. The NS3 protein of JEV was detected in C6/36 cells after transfection with pGL3-A4-JENS3 and pGL3-B1-JENS3 plasmids, and the NS3 of DenV2 was expressed in CCL125 cells transfected with pGL3-A4-D2NS3 and pGL3-B1-D2NS3 [Figure 5]a. These data revealed that the promoters of these AMP genes from mosquito could be used to drive individual viral gene expression in mosquito cell lines without whole virus infection. We further tested whether these promoters could drive JEV NS3 gene expression in adult mosquito by intrathoracic injection of Ae. albopictus [Figure 5]b, upper panels, middle, and right] and Cx. tritaeniorhynchus [Figure 5]b, lower panel, middle, and right] females with pGL3-A4-JENS3 or pGL3-B1-JENS3 plasmid (~50 ng DNA per adult mosquito) for 5 days. The injected mosquitoes were formalin fixed and paraffin embedded, and sliced sections were dewaxed in xylene, rehydrated through graded alcohol, and stained by immunohistochemistry with specific anti-JEV NS3 monoclonal antibody. The results showed that the NS3 protein was expressed in brain neuronal cells and fat body, both in Aedes and Culex mosquitoes. For comparison, JEV-positive infection of adult mosquitoes after intrathoracic injection with 300 pfu viruses for 5 days is also shown in [Figure 5]b (left panels).
Figure 5: (a) The viral protein NS3 of JEV and DenV2 can be expressed in mosquito cells under the control of A4 and B1 promoters. Plasmids – pGL3-A4-JENS3, pGL3-B1-JENS3, pGL3-A4-D2NS3, and pGL3-B1-D2NS3 were transiently transfected into C6/36 and CCL125 mosquito cells for 48 h. The cells were lysed and the lysates were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred onto nitrocellulose membrane and probed with monoclonal antibodies against NS3 of JEV and DenV2. C6/36 and CCL125 cells were also infected with JEV or DenV2 virions as a positive control. (b) The JEV NS3 gene alone can be expressed in adult mosquitoes. Aedes albopictus (upper panels) and Culex tritaeniorhynchus (lower panels) adult were intrathoracically injected with pGL3-A4-JENS3 or pGL3-B1-JENS3 (98 nl containing ~50 ng DNA per mosquito) and left for 5 days. The injected mosquitoes were formalin fixed and paraffin embedded, and 5-microm sliced sections were dewaxed in xylene, rehydrated through graded alcohol, and stained by immunohistochemistry with specific anti-JEV NS3 antibody. The brown/red areas indicate positive NS3 protein expression in mosquito brain neuronal cells and fat body. The left panels show JEV-infected tissue as a positive control. Scale bar = 10 μm

Click here to view



  Discussion Top


Ae. aegypti transmits viruses causing dengue fever, yellow fever, chikungunya fever, and Zika fever, which are among the greatest public health burdens in many countries. The main reasons for this dire situation are the unavailability of effective antivirus vaccines (except for yellow fever), lack of therapeutic drugs, development of insecticide resistance in mosquitoes, and unsuccessful vector control. Therefore, there is an urgent need to explore other possible avenues for developing novel control strategies against these mosquito-borne viruses, such as by genetically engineering mosquitoes to have pathogen-resistant phenotypes, or by using molecular approaches in mosquito itself to identify and neutralize potential viral gene targets that counteract mosquito immune competence. Generation of pathogen-resistant or immunocompetent transgenic mosquitoes requires a promoter that can drive the expression of effector molecules, ectopic genes, siRNA, or viral genes in an appropriate manner.[2],[4],[20],[21],[22]

We showed here that the promoters from the AMP genes – defensin A1, defensin A4, and cecropin B1, but not the Hsp promoter, could effectively drive constitutive expression of luciferase, GFP, and glycosylated G protein of rabies virus in cell lines without external stimulation such as heat shock. These novel promoters could also drive both flavivirus NS3 and GFP expression in adult mosquito tissues, including neuronal cells and fat body of Ae. aegypti, Ae. albopictus, and Cx. tritaeniorhynchus in vivo without external induction such as blood feeding.

The innate immune response of Ae. aegypti, like that of Drosophila and other insects, can protect the mosquito from invasion by pathogens through rapid and potent production of immune peptides, including defensins, cecropins, and several other AMPs which are secreted into the hemolymph.[23],[24],[25],[26],[27],[28],[29] The promoters of these insect AMP genes contain several functional domains, such as kappaB-like motifs, GATA motifs, C/EBP binding sites, or acute-phase response elements, which are very similar to those of mammalian promoters.[30],[31],[32],[33],[34],[35] The immune response mediated by these defense genes is induced by the Toll and/or Imd signaling pathways through binding the downstream transcription factors – Dorsal and Relish, respectively, to regulatory elements of AMP genes, thereby activating transcription and secretion of immune peptides against fungi, Gram-positive, and Gram-negative bacteria and restrict virus replication.[36],[37],[38],[39],[40],[41],[42],[43]

Tzou et al. used several promoters from Drosophila AMP genes to construct GFP reporter transgenes and demonstrated that AMPs can be induced in surface epithelia in a tissue-specific manner, and some promoters were constitutively active in various regions of particular tissues.[44] The NF-kappaB transcription factor plays a major role in the induction of AMP expression, and the Drosophila homeobox gene caudal functions as immune transcription modulator for constitutive expression of AMPs.[45] AMPs were demonstrated to be expressed constitutively in the malpighian tubules of Drosophila, which function as autonomous immune sensing organs.[46] Accordingly, in our experiments which demonstrated constitutive expression of GFP, luciferase, NS3, or G protein under the control of the A4 and B1 promoters without external induction, the genes may be regulated by transcription factors or homeobox-containing proteins other than, or in addition to, NF-kappaB. Expression of GFP by the A4 or B1 promoter in the fat body of adult female mosquitoes in vivo[Figure 4] suggest that this main AMP producing organ, equivalent to the mammalian liver, could respond to microbe invasion by secreting AMPs into the hemolymph.[25]

The G protein of rabies virus induces neutralizing antibodies, which are important in protection against rabies. Following the work of Dos Santos et al., who used the Drosophila actin promoter to drive rabies G protein expression in S2 cells,[47] we constructed a B1 promoter to successfully drive rabies G protein production in a mosquito cell line [Figure 2]d.

Cao et al. recovered a mutant of dnr1, a negative regulator of the Imd immune pathway, and found this mutant to exhibit neurodegeneration and elevated expression of AMP genes.[48] Petersen et al. demonstrated an association between the innate immune response and neurodegeneration in a Drosophila model of the human disease Ataxia–telangiectasia, with elevated expression of innate immune response genes in glial cells.[49],[50] We showed ectopic expression of the NS3 protein of JEV not only in the fat body but also in brain neuronal cells of two species of mosquito [Figure 5]b, and suspected that AMP genes could be implicated in mosquito brain inflammation.

Our finding that the promoters of mosquito AMP genes are able to drive expression of luciferase or GFP proteins in insect cells [Figure 1] and [Figure 3], NS3 proteins of JEV or DenV2 in both mosquito cell lines and adult mosquitoes [Figure 5], G protein of rabies virus in mosquito cells [Figure 2]d, and NS3 protein in fat body [Figure 4] and neuronal cells of Ae. albopicus and Cx. tritaeniorhynchus [Figure 5]b, indicates that these mosquito promoters (especially A4 and B1) are robustly active and evolutionarily conserved within the mosquito lineage and could be used for exogenous protein expression in mosquito species in vitro and in vivo.

Acknowledgments

We thank Daryl Henderson for proofreading the manuscript.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Antonova Y, Alvarez KS, Kim YJ, Kokoza V, Raikhel AS. The role of NF-kappaB factor REL2 in the Aedes aegypti immune response. Insect Biochem Mol Biol 2009;39:303-14.  Back to cited text no. 1
    
2.
Franz AW, Sanchez-Vargas I, Adelman ZN, Blair CD, Beaty BJ, James AA, et al. Engineering RNA interference-based resistance to dengue virus type 2 in genetically modified Aedes aegypti. Proc Natl Acad Sci U S A 2006;103:4198-203.  Back to cited text no. 2
    
3.
Kokoza V, Ahmed A, Cho WL, Jasinskiene N, James AA, Raikhel A, et al. Engineering blood meal-activated systemic immunity in the yellow fever mosquito, Aedes aegypti. Proc Natl Acad Sci U S A 2000;97:9144-9.  Back to cited text no. 3
    
4.
Mathur G, Sanchez-Vargas I, Alvarez D, Olson KE, Marinotti O, James AA, et al. Transgene-mediated suppression of dengue viruses in the salivary glands of the yellow fever mosquito, Aedes aegypti. Insect Mol Biol 2010;19:753-63.  Back to cited text no. 4
    
5.
Adelman ZN, Jasinskiene N, Onal S, Juhn J, Ashikyan A, Salampessy M, et al. Nanos gene control DNA mediates developmentally regulated transposition in the yellow fever mosquito Aedes aegypti. Proc Natl Acad Sci U S A 2007;104:9970-5.  Back to cited text no. 5
    
6.
Fu G, Lees RS, Nimmo D, Aw D, Jin L, Gray P, et al. Female-specific flightless phenotype for mosquito control. Proc Natl Acad Sci U S A 2010;107:4550-4.  Back to cited text no. 6
    
7.
Smith RC, Walter MF, Hice RH, O'Brochta DA, Atkinson PW. Testis-specific expression of the beta2 tubulin promoter of Aedes aegypti and its application as a genetic sex-separation marker. Insect Mol Biol 2007;16:61-71.  Back to cited text no. 7
    
8.
Carpenetti TL, Aryan A, Myles KM, Adelman ZN. Robust heat-inducible gene expression by two endogenous hsp70-derived promoters in transgenic Aedes aegypti. Insect Mol Biol 2012;21:97-106.  Back to cited text no. 8
    
9.
Anderson MA, Gross TL, Myles KM, Adelman ZN. Validation of novel promoter sequences derived from two endogenous ubiquitin genes in transgenic Aedes aegypti. Insect Mol Biol 2010;19:441-9.  Back to cited text no. 9
    
10.
Coates CJ, Jasinskiene N, Pott GB, James AA. Promoter-directed expression of recombinant fire-fly luciferase in the salivary glands of Hermes-transformed Aedes aegypti. Gene 1999;226:317-25.  Back to cited text no. 10
    
11.
Niu LL, Kiley LM, Dasgupta R, Kohler P, Christensen BM. Three regulatory regions of the Aedes aegypti glutamine synthetase gene differentially regulate expression: Identification of a crucial regulator in the first exon. Insect Mol Biol 2003;12:571-9.  Back to cited text no. 11
    
12.
Moreira LA, Edwards MJ, Adhami F, Jasinskiene N, James AA, Jacobs-Lorena M, et al. Robust gut-specific gene expression in transgenic Aedes aegypti mosquitoes. Proc Natl Acad Sci U S A 2000;97:10895-8.  Back to cited text no. 12
    
13.
Pham DQ, Chavez CA. The ferritin light-chain homologue promoter in Aedes aegypti. Insect Mol Biol 2005;14:263-70.  Back to cited text no. 13
    
14.
Raikhel AS, Kokoza VA, Zhu J, Martin D, Wang SF, Li C, et al. Molecular biology of mosquito vitellogenesis: From basic studies to genetic engineering of antipathogen immunity. Insect Biochem Mol Biol 2002;32:1275-86.  Back to cited text no. 14
    
15.
Bian G, Shin SW, Cheon HM, Kokoza V, Raikhel AS. Transgenic alteration of toll immune pathway in the female mosquito Aedes aegypti. Proc Natl Acad Sci U S A 2005;102:13568-73.  Back to cited text no. 15
    
16.
Shin SW, Kokoza V, Lobkov I, Raikhel AS. Relish-mediated immune deficiency in the transgenic mosquito Aedes aegypti. Proc Natl Acad Sci U S A 2003;100:2616-21.  Back to cited text no. 16
    
17.
Lin CC, Chou CM, Hsu YL, Lien JC, Wang YM, Chen ST, et al. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection. J Biol Chem 2004;279:3308-17.  Back to cited text no. 17
    
18.
Gubler DJ, Rosen L. A simple technique for demonstrating transmission of dengue virus by mosquitoes without the use of vertebrate hosts. Am J Trop Med Hyg 1976;25:146-50.  Back to cited text no. 18
    
19.
Isoe J, Kunz S, Manhart C, Wells MA, Miesfeld RL. Regulated expression of microinjected DNA in adult Aedes aegypti mosquitoes. Insect Mol Biol 2007;16:83-92.  Back to cited text no. 19
    
20.
Olson KE, Adelman ZN, Travanty EA, Sanchez-Vargas I, Beaty BJ, Blair CD, et al. Developing arbovirus resistance in mosquitoes. Insect Biochem Mol Biol 2002;32:1333-43.  Back to cited text no. 20
    
21.
Shin SW, Kokoza VA, Raikhel AS. Transgenesis and reverse genetics of mosquito innate immunity. J Exp Biol 2003;206:3835-43.  Back to cited text no. 21
    
22.
Zou Z, Souza-Neto J, Xi Z, Kokoza V, Shin SW, Dimopoulos G, et al. Transcriptome analysis of Aedes aegypti transgenic mosquitoes with altered immunity. PLoS Pathog 2011;7:e1002394.  Back to cited text no. 22
    
23.
Bartholomay LC, Fuchs JF, Cheng LL, Beck ET, Vizioli J, Lowenberger C, et al. Reassessing the role of defensin in the innate immune response of the mosquito, Aedes aegypti. Insect Mol Biol 2004;13:125-32.  Back to cited text no. 23
    
24.
Lazzaro BP. Natural selection on the Drosophila antimicrobial immune system. Curr Opin Microbiol 2008;11:284-9.  Back to cited text no. 24
    
25.
Lemaitre B, Hoffmann J. The host defense of Drosophila melanogaster. Annu Rev Immunol 2007;25:697-743.  Back to cited text no. 25
    
26.
Lemaitre B, Reichhart JM, Hoffmann JA. Drosophila host defense: Differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc Natl Acad Sci U S A 1997;94:14614-9.  Back to cited text no. 26
    
27.
Lowenberger C. Innate immune response of Aedes aegypti. Insect Biochem Mol Biol 2001;31:219-29.  Back to cited text no. 27
    
28.
Lowenberger C, Bulet P, Charlet M, Hetru C, Hodgeman B, Christensen BM, et al. Insect immunity: Isolation of three novel inducible antibacterial defensins from the vector mosquito, Aedes aegypti. Insect Biochem Mol Biol 1995;25:867-73.  Back to cited text no. 28
    
29.
Meister M, Lemaitre B, Hoffmann JA. Antimicrobial peptide defense in drosophila. Bioessays 1997;19:1019-26.  Back to cited text no. 29
    
30.
Dimarcq JL, Hoffmann D, Meister M, Bulet P, Lanot R, Reichhart JM, et al. Characterization and transcriptional profiles of a Drosophila gene encoding an insect defensin. A study in insect immunity. Eur J Biochem 1994;221:201-9.  Back to cited text no. 30
    
31.
Engström Y, Kadalayil L, Sun SC, Samakovlis C, Hultmark D, Faye I, et al. Kappa B-like motifs regulate the induction of immune genes in drosophila. J Mol Biol 1993;232:327-33.  Back to cited text no. 31
    
32.
Georgel P, Meister M, Kappler C, Lemaitre B, Reichhart JM, Hoffmann JA, et al. Insect immunity: The diptericin promoter contains multiple functional regulatory sequences homologous to mammalian acute-phase response elements. Biochem Biophys Res Commun 1993;197:508-17.  Back to cited text no. 32
    
33.
Meredith JM, Munks RJ, Grail W, Hurd H, Eggleston P, Lehane MJ, et al. A novel association between clustered NF-kappaB and C/EBP binding sites is required for immune regulation of mosquito defensin genes. Insect Mol Biol 2006;15:393-401.  Back to cited text no. 33
    
34.
Petersen UM, Kadalayil L, Rehorn KP, Hoshizaki DK, Reuter R, Engström Y, et al. Serpent regulates Drosophila immunity genes in the larval fat body through an essential GATA motif. EMBO J 1999;18:4013-22.  Back to cited text no. 34
    
35.
Senger K, Armstrong GW, Rowell WJ, Kwan JM, Markstein M, Levine M, et al. Immunity regulatory DNAs share common organizational features in drosophila. Mol Cell 2004;13:19-32.  Back to cited text no. 35
    
36.
Bulet P, Stöcklin R, Menin L. Anti-microbial peptides: From invertebrates to vertebrates. Immunol Rev 2004;198:169-84.  Back to cited text no. 36
    
37.
Ganesan S, Aggarwal K, Paquette N, Silverman N. NF-κB/Rel proteins and the humoral immune responses of Drosophila melanogaster. Curr Top Microbiol Immunol 2011;349:25-60.  Back to cited text no. 37
    
38.
Imler JL, Bulet P. Antimicrobial peptides in drosophila: Structures, activities and gene regulation. Chem Immunol Allergy 2005;86:1-21.  Back to cited text no. 38
    
39.
Ip YT, Reach M, Engstrom Y, Kadalayil L, Cai H, González-Crespo S, et al. Dif, a dorsal-related gene that mediates an immune response in drosophila. Cell 1993;75:753-63.  Back to cited text no. 39
    
40.
Myllymäki H, Valanne S, Rämet M. The Drosophila imd signaling pathway. J Immunol 2014;192:3455-62.  Back to cited text no. 40
    
41.
Ramirez JL, Dimopoulos G. The toll immune signaling pathway control conserved anti-dengue defenses across diverse Ae. Aegypti strains and against multiple dengue virus serotypes. Dev Comp Immunol 2010;34:625-9.  Back to cited text no. 41
    
42.
Valanne S, Wang JH, Rämet M. The Drosophila toll signaling pathway. J Immunol 2011;186:649-56.  Back to cited text no. 42
    
43.
Xi Z, Ramirez JL, Dimopoulos G. The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog 2008;4:e1000098.  Back to cited text no. 43
    
44.
Tzou P, Ohresser S, Ferrandon D, Capovilla M, Reichhart JM, Lemaitre B, et al. Tissue-specific inducible expression of antimicrobial peptide genes in Drosophila surface epithelia. Immunity 2000;13:737-48.  Back to cited text no. 44
    
45.
Ryu JH, Nam KB, Oh CT, Nam HJ, Kim SH, Yoon JH, et al. The homeobox gene caudal regulates constitutive local expression of antimicrobial peptide genes in Drosophila epithelia. Mol Cell Biol 2004;24:172-85.  Back to cited text no. 45
    
46.
Verma P, Tapadia MG. Immune response and anti-microbial peptides expression in malpighian tubules of Drosophila melanogaster is under developmental regulation. PLoS One 2012;7:e40714.  Back to cited text no. 46
    
47.
Dos Santos AS, Lemos MA, Pereira CA, Jorge SA. Rabies virus glycoprotein expression in Drosophila S2 cells: Influence of re-selection on protein expression. Biotechnol J 2009;4:1578-81.  Back to cited text no. 47
    
48.
Cao Y, Chtarbanova S, Petersen AJ, Ganetzky B. Dnr1 mutations cause neurodegeneration in Drosophila by activating the innate immune response in the brain. Proc Natl Acad Sci U S A 2013;110:E1752-60.  Back to cited text no. 48
    
49.
Petersen AJ, Rimkus SA, Wassarman DA. ATM kinase inhibition in glial cells activates the innate immune response and causes neurodegeneration in drosophila. Proc Natl Acad Sci U S A 2012;109:E656-64.  Back to cited text no. 49
    
50.
Petersen AJ, Wassarman DA. Drosophila innate immune response pathways moonlight in neurodegeneration. Fly (Austin) 2012;6:169-72.  Back to cited text no. 50
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  Materials and Me...
  In this article
Abstract
Introduction
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed416    
    Printed31    
    Emailed0    
    PDF Downloaded91    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]